An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT064221.1

General info


NONCODE TRANSCRIPT IDNONHSAT064221.1
NONCODE Gene IDNONHSAG025469.1
Chromosomechr19
Start Site33315047
End Site33315411
Strand-
Exon Number1
CNCI Score-0.0194981
Length364
Assemblyhg19
Other transcript VersionsNONHSAT064221.2

Sequence


>NONHSAT064221.1
GAGCACAGCTACAGCTAGGAGGGCAAGAGCAGGCAGCAGCCCCCGAGCCGGGCCACATGCAACACAAACAACCCCACACCTGCGTCCTCCAGAAGCCCTGCCTGGCACAGTGGCATGCGGGTGTCACGTCTGCAGAGGAGGGCACGGGGTCCACCTGAGACCGACCAGCTGCAGCAGGGCTGGCAGATCCTGCGGAGGAATGCTGCCCTAACTGTGATGAGCCTCTGAAGCTCAGGCCTTGCCCCTCACCAGCGTGTGGCAGCACAATGGATGCATCATACTTTTCTAGCCACATGGAGACACTGACTGTCCAAATACCAGAAACCCTGCGGGAAGCCAAGGCAAGAAGAACCATGAAGAAAGT

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT064221
lncipedialnc-SLC7A9-1-1_dup1
ensemblENST00000590892