An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT065821.1

General info


NONCODE TRANSCRIPT IDNONHSAT065821.1
NONCODE Gene IDNONHSAG025570.2
Chromosomechr19
Start Site35310608
End Site35313554
Strand+
Exon Number4
CNCI Score-0.0770048
Length442
Assemblyhg38
Other transcript VersionsNONHSAT065821.1(old version)

Sequence


>NONHSAT065821.1
GCCATCGTCTGCTACATTACCCAGACACGCAGGAAAAGAACGTGACAGAGAGCCCCAGCTTCTCGGCAGGGGACAACCCTCCCGTCCTGTTCAGCAGCGACTTCCGCATCTCTGGGGCACCAGAGAAGTACGAGCCAAAGAGGTTTCTACCCTGGAATCTCACTGAGTGCCCCAGGAGGCGAGAGGCGCCTGGGATCTGAGAGGAGGCTGCTGGGCCTTCGGGGTGAGCCCCCAGAGCTGGACCTGAGCTATTCTCACTCGGACCTGGGGAAACGGCCCACCAAGGACAGCTACACGCTGACGGAGGAGCTAGCTGAGTATGCTGAAATCCGGGTCAAGTGAAGGAGCTGGGGGCAGCCTGCGTGGCTGACCCCCCTCAGGACCCTCGCTGGCCCCCACTGGCTGTGGGCTCCCTTCCTCCCAAAAGTATCGGGGGCTGGGG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA226782
NONCODEv4NONHSAT065821
lncipedialnc-CD22-1-1
noncodeV3n336227