An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT065821.1

General info


NONCODE TRANSCRIPT IDNONHSAT065821.1
NONCODE Gene IDNONHSAG025570.1
Chromosomechr19
Start Site35801511
End Site35804457
Strand+
Exon Number4
CNCI Score-0.1882108
Length442
Assemblyhg19
Other transcript VersionsNONHSAT065821.2

Sequence


>NONHSAT065821.1
GCCATCGTCTGCTACATTACCCAGACACGCAGGAAAAGAACGTGACAGAGAGCCCCAGCTTCTCGGCAGGGGACAACCCTCCCGTCCTGTTCAGCAGCGACTTCCGCATCTCTGGGGCACCAGAGAAGTACGAGCCAAAGAGGTTTCTACCCTGGAATCTCACTGAGTGCCCCAGGAGGCGAGAGGCGCCTGGGATCTGAGAGGAGGCTGCTGGGCCTTCGGGGTGAGCCCCCAGAGCTGGACCTGAGCTATTCTCACTCGGACCTGGGGAAACGGCCCACCAAGGACAGCTACACGCTGACGGAGGAGCTAGCTGAGTATGCTGAAATCCGGGTCAAGTGAAGGAGCTGGGGGCAGCCTGCGTGGCTGACCCCCCTCAGGACCCTCGCTGGCCCCCACTGGCTGTGGGCTCCCTTCCTCCCAAAAGTATCGGGGGCTGGGG

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
PMID26117828PNCT_HSA226782
NONCODEv4NONHSAT065821
lncipedialnc-CD22-1-1
noncodeV3n336227