An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT067446.1

General info


NONCODE TRANSCRIPT IDNONHSAT067446.1
NONCODE Gene IDNONHSAG026370.2
Chromosomechr19
Start Site51508572
End Site51509311
Strand+
Exon Number2
CNCI Score-0.0114688
Length545
Assemblyhg38
Other transcript VersionsNONHSAT067446.1(old version)

Sequence


>NONHSAT067446.1
GTCCATGTGCCCTGCTCCTTCTGCTACCCCCAAGACAGCTGGACTGACTCTGACCCACTTCACAGCTATTGGTTAGGGGAAGTGGCCCTTCCAGCCTCAGATGCTCCAGTGGCCACAAACAACCCAGATAGAAAAGTGCAGGAGGAGACCCAGGGACAGTTGCAACTTTCCAGGGACCGACAGATCAATGACTGCTCCCTGAGGGGTCATACTTCTTTCACATGGAGGGAGGGAATATGAAATGGAGATACAAAATTAACCAGTTGTCCATGCATGTGATGCGTAAGGCATGGGCGTCCAACCCACAGGCCCGACATCTTCATCCCAATAACCCTGGAGTCGGCTGCCCCAGCAATCTAACCTGCTCTGTGCCTTGGGCCTGTGAGCAGGGGATGCCTCCGACAATCACCTGGATGGGGCCTCCATGTTCCCACTGGGCTCCACCTCGGTGCCCTCCACAGTCCAGGACCACGACGCCAGCCTCACCTGTCAGGTGACTTTACCGAGGGCTGGTGTGACCACGAACAGTAACATCCAACTCAATG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT067447.2

Data Sources

Source NameOld Id
ensemblENST00000594477
PMID26117828PNCT_HSA058654
lncipedialnc-CEACAM18-3-1_dup1
NONCODEv4NONHSAT067446