An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT067681.1

General info


NONCODE TRANSCRIPT IDNONHSAT067681.1
NONCODE Gene IDNONHSAG026464.2
Chromosomechr19
Start Site53455059
End Site53457413
Strand-
Exon Number2
CNCI Score-0.1966080
Length1906
Assemblyhg38
Other transcript VersionsNONHSAT067681.1(old version)

Sequence


>NONHSAT067681.1
CATGTGAGGTTTCTCTCCTGTATGAATTCTCCTATGTTTTGCATAGGATGAAGCTTGACTGAAGACCTTGCCACAGTCATGACATTTGTAAGGTTTCTCTCCAGCGTTGAGTTCACCGATGAACTGCAAGGTATGAACAATGTCTGAAAAATCTGCCACATTTATTACCCTAGTATGATCTCTCTTCCTTATGGATTCTCCAGTGATTCACAATGGTTGTAGCATTACTGAAGACTTTGTGACAATCATTACCTTAGTAAAGTTTCCCTACACCATGGATTGCCTGACGGTAAACAAGTGTTGACTGCCTACTAAAGGCTTTGCCACACTCATTACACTGGTAAGGTTTCTCTCCAGTGTGAATTCTAGCATGTTGTGCCAGGTGCGAATCATGCCCAAAAGCCTTGTCACAAACTCTTACATTTTTATGGTTTCTCTCCAGTATGAATTCTCCTGTCTTTCACGGTTTGATGTGCGACTGTAAACTTTGTGACATTCTTCACATTTATAAGCTTTCTCTCCAGTATGAATTCTCCTGTCTTCTGAGGCTTGATTTGCCACTGTAAACTTTATCACATGCTTCACATTTCTAAGGTTTCTCCCCAGTATGAATTCTATGATGACCTGCAAGGTGTGCTTGTTGATTAAAAACCTCACCACATTCATTACACTTGTTTTTCTCCAGTATGAAGTCTACGATGGCATGTAAGGTTTGACTTCTGACTAAAGGTCTTGCCACACTCATTACACTTGTAAGGTTTCTCTCCAGTATGAAGTCTATGGTGGCATATAAGGGATGACTTCTGACTAAAGTTCTTGCCACACTCATTACACTTATAAGGTTTCTCTCCAGTATGAAGTCTATGATGGCATATAAAATATGACTTCCGACTAAAGGTCTTGCCACACTCATTACACTTGTAAGGTTTCTCTCCAGTATGAATTCTCCTATGTCCTTCAAGGTTTGATTTCACACGGAAAGCTTTGTCACATTCTTCACATTTGTAAGGTTTCTCTCCGGTATGAAGTCTACGATGGCATGTAAGGGATGACGTCCGACTGAAGGTCTTGCCACACTCATTACACTTGTAAGGATTCTCTTCAGTATGAATTTTCTGATGTATTTCAAGGTTTGATTTGAAACTGTAAGCTTTGTCACTATCTTCACATTTGTAAGGGTTCTCTCCACTATGAAGTCTACGATGGCGTTTAAGGGTTAACTGCTGATTGAAGGTCTTGCCACACTCCTTACACTTGTAAGGTTTCTCTCCAGAATGAAGTCTACGATGGCAGGTAAGGGATGACTTCCAACTAAAGGTCTTGCCGCACTCATTACACTTGTAAGCTTTCTCTCCAGTATGAAGTCTATGATGGCATGTGAGGTATGACTTCCGACTAAAGGTCTTGCCACACTCATTACACTTGTATGGTTTCTCTCCAGTATGAATTCTCCTATGTCTTTCAAGGTTTGATTTGAAACGGAAAGCTTTGTCACATTCTTCACATTTGTAAGGTTGCTCTCCAGTATGACGTCTACGATGGCATGTAAGGGATGATGTCCGGCTAAAGGTTTCTCTCCAGTATGAAGTCTACGATGGCATGTAAGGGATGACGTCTGACTGAAGGTCTTGCCACACTCATTACACTTGTAAGGATTCTCACCAGTGTGACATCTACGATGGCATGCTAGGTTTCGCTTCTGATTAAAGAGCTTGCCACATACATCACATTTATATTTGTCTGCTAAATGGATTATCTGATGTTTCCTTAAGAGTGAGCTGTAATTAAAGGCTTTGCCACTCTCATTACATTGGAAAGATTTTTCTCTCATGTGTACTTCCTGTTTTTGTGTGAGTAATGAAGAATTCCAGAAATTATTCCCATGGTTATTAGATATATGGGTTTT

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT067681
PMID26117828PNCT_HSA058845
PMID26117828TCONS_00018740
lncipedialnc-BIRC8-3-1_dup1