An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT069694.2

General info


NONCODE TRANSCRIPT IDNONHSAT069694.2
NONCODE Gene IDNONHSAG027286.2
Chromosomechr2
Start Site26457982
End Site26460708
Strand-
Exon Number2
CNCI Score-0.0073728
Length299
Assemblyhg38
Other transcript VersionsNONHSAT069694.1(old version)

Sequence


>NONHSAT069694.2
GAGGCAGAGAAGAACCCAGTGGGCCTGGCCCGCAATGAACCTGACCCCCTAGAGAAACCCACCGGCCCGACACGGCCTTCGTCTGGTTCCTCAACCCTCTCAAGTCCATCAAGTACCTCATCTGCACCCGGTACAAGTGGCTCATCATCAAGATCGTGCTGGCGCTGTTGGGGCTGCTCATGTTGGGGCTCTTCCTCTACAGCCTCCCTGGCTACATGGTCAAAAAGCTCCTTGGGGCATGAAGGCCGCCAGCTCCCGCCAGCCGCTCCCCAGCCCTGCCGCATTTCCTTTCAGTGGCT

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
00.5387420000
foreskinheartheart_RHLF_1HLF_2kidney
0.372710.4107190000.663403
liverliver_RlunglymphNodeovaryplacenta_R
00000.5252830.389013
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0000.28081800
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00.67385701.5290129.675
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
60.98550042.92050
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset