An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT071626.1

General info


NONCODE TRANSCRIPT IDNONHSAT071626.1
NONCODE Gene IDNONHSAG028182.1
Chromosomechr2
Start Site73898156
End Site73912212
Strand+
Exon Number6
CNCI Score-0.1099988
Length921
Assemblyhg19
Other transcript VersionsNONHSAT071626.2

Sequence


>NONHSAT071626.1
GTGGCAAACCATGTGATTTCTTCTGACTCTATTTCCTCTTCTGCCAGTAGTTTCCTGAGCTCGAACTCTACTTTTTGCAACAAGCAGAATGTACACATGTTAAACAAGGGCACACAAGCAGGTAACTTGGAGATTGTGAACGGTGCCGAAAAACACACTCGAGCCAACTCCAAGTTCCAGCGAGGCTAAATTGGAAGAGGACAGTGATGTGACTTCTTGGTCAGAAGAAAAACATGAAGAGAAAATGCTCTTTACCAGTTATCCTGAGGACAGAAAGTTAAAAAAGAACAAGAAGAATTCCCATGAAGGAGTTTCCTGGTTTGTTCCTGTGGAAAATGTGGAGTCTAGATAAAAAGAAGGAAAACATGCTCAAGACTCATGACCCTGGCATCTCCCGGTTGGAACCAGTAACCAAGACCAAGCCGTGGAGGGAGCCACTGTGGGAGCGGAACTGGCAGGGGCAGCACCTGGACAGTCGGGGCTACCTGGCAGGCCCAGGCAGAGAGGATGGCAGAAACCCACTGAAGCTGTTTGTGAGAGCAACCCTGCGAATCGCTTCAGTTTCACAGACCTGACTTCATCTCCCACATTGGGGAGCGGATAAAGCGTCTGAAGTTAATAGTCCAGGAGAGAAAGCTGCAGAGCATGTTAAAGAGCGAGCGGGATGCGCTATTCGACATTGACAGGGAACGGCAGGGCCACCAGAATCGCATGCGCCCACTACCCAAGAGTCTTCCTGGCTGTCCAGAAGAACAAGCCTATCAGCAAGAAGGAAATGATTCAGAGGTCCAAACAGGACACACGCAGGAGGAACAGTAGCACAAAGGCTTCCCGGTGCCTTGTGGGTGAAAGAAAGGCTTCCAGGGAAAGGAGAGAAACACCCAGGGATCCCGGTGACGTCGGGAAGCAGCACCCAGACCA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA063395
NONCODEv4NONHSAT071626
ensemblENST00000428767
lncipedialnc-ALMS1-3-2