An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT077403.1

General info


NONCODE TRANSCRIPT IDNONHSAT077403.1
NONCODE Gene IDNONHSAG030792.2
Chromosomechr2
Start Site232379758
End Site232381037
Strand-
Exon Number2
CNCI Score-0.1351680
Length356
Assemblyhg38
Other transcript VersionsNONHSAT077403.1(old version)

Sequence


>NONHSAT077403.1
GCCTACCGAAGATGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTGAGCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGCCCTTGGCCTGGGGGTCGCACGTCAATGTCCATGTTGGAGATGAGCTGCGTAGCGATGTCCTGGCACCCCTCCTGGCGGGCGGAGGCAGGCACGTCGGCGTCCGAGTACCAGTTGCGGTTCACCGTGTGGGCGTAGGTGCCGGCTGGCGAGGCGTGCTGCACTCGTGTGGTGGTTACCACTCCCACTGACTTCCCTAAG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT186430.1
NONHSAT077402.2

Data Sources

Source NameOld Id
PMID26117828TCONS_00021055
ensemblENST00000439072
NONCODEv4NONHSAT077403
lncipedialnc-ECEL1-2-2
gencodeENST00000439072.1
PMID26117828PNCT_HSA070199