An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT078524.1

General info


NONCODE TRANSCRIPT IDNONHSAT078524.1
NONCODE Gene IDNONHSAG031219.2
Chromosomechr20
Start Site6200988
End Site6202191
Strand-
Exon Number1
CNCI Score-0.0405504
Length1203
Assemblyhg38
Other transcript VersionsNONHSAT078524.1(old version)

Sequence


>NONHSAT078524.1
ATGTCTGAATACACTAGGGTAAGTGAAGTTGAGAATAAGGAGCTCGTTGAAATATCATCAGAAGACAATGGGGTGGTGCTGCTGTCCACAGTTACAGCCCAGTTTCCAGGGGCATGTGGACTTCACTACAAGAATCCAGTGTCTCAGTGTATGAGAGGTATCCAGCTGGTAGAAGGAATTCTGCATGCCCTGATGCTGACTGTGGAAATCTGGTATATGTTGTCAACTGTCCCAAAGATAACAAAAGAAAAATGGGTGAGACGGCAGTGAAAGTGAAGAGCAGTCCAGAAAATATCTTATTTAATAGCGTTGGTAATTAGTGAGTTTTTGCTCTCAGTTTGTTTTTCCTCCTATGGAAACAGGATCTGAAAGAATATTTTAGTACCTCTGGAGAAGTCCAAGTCAAGATAGATATTAAAACTGGTCAAAAGGGTTTGGCTTTGTTCATTTTATGGAGTATGAAAGACACGTGAAAGTAATGTCACAGTGACATATGATAGATGGATGATGGTATGACTGTAAATTTCCCAACTCTAAGCAAAGCCCAGATGAGCCTTTGAGAAGCAGAGAAGTGTTTGTGGGGCGCTGTACAGAGGACATGACTGCAGATGAGCTATGGCAGTTTTTCTGTCAGTACAAAGAAGTGGTGGATGTCTTCATCCCCAAGCCATTCAGGGCCTTTGCCTTTGTTACATTTGCAGTTGATCAGATTGCCCAATCTCTTTGTGGAGAGGACTTGATCATTAAAGGACTCAGCATGCATATATCCAGTGCCAAACCTAATCACACGACAGCAATAGATAGAAAGAAGTGGAAGATTTGGGAATCTGAGTGGATTTGGTAACAGTAGAGGGGTGGATCTGGCTTGGAAAACAATCGAGGTACCAATACAGGTGGTAGATGAATTTTGGTGTGCTCAGCATTAATCCAGCCATGATGGCTGCAGCCCAGGCAGCGCTGCAGAGCAGTTGGGGTAGGATGAGCATGTTAGCCAGCCAGCAGAACCAGTCAGGCCCATCAGGTAATAACCAAAGTCAAGGCAACATGCAAAGGGAGCCAAACCAGGTCTTTGGTTCTAGAAATAACTCTTACAGTGGTTCTAATTCTGGTGCAGCAATTGGTTGGGAATCAGCATCAGGCAATGGTTTTAATGGAGGCTCTGGCTCAAGCATGGATTCTCAATCTTCTGGCTGGGAAATGTAG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000442013
NONCODEv4NONHSAT078524
lncipedialnc-FERMT1-2-1_dup1