An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT079405.1

General info


NONCODE TRANSCRIPT IDNONHSAT079405.1
NONCODE Gene IDNONHSAG031635.2
Chromosomechr20
Start Site33752166
End Site33752543
Strand-
Exon Number1
CNCI Score-0.0327680
Length377
Assemblyhg38
Other transcript VersionsNONHSAT079405.1(old version)

Sequence


>NONHSAT079405.1
ATGGCTCCCAGAAAGAAGGGTGGCGAGAAGAAAAAGGGTCATTCGGCCATCAATGAGGTGGTGACCTGAGAATACACCATCAACATTCACAAGTGCATCCATGGAGTGGCTTCAAGAAGCGTGCTCCTCAGGCACTCAAAGAGATTCGGAAACTTGCCATGAAGGAGATGGGAACTCCAGATGTGTGCATTGATACCAGCCTCAACAAAGCTGTCTGAGACAAAGGAATAAAGAATGTCCCATACTGCATCCGTGTGCGGTTGTCCAGAAAATGTTATGAGGATGAAGATCCACCAAATAAGCTCTATACTTTGGTTACCTATGTACCTGTTACCACTTTCAAAAATCTACAGACAGTCAATGTGGATGAGAACTAA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT079405
lncipedialnc-PXMP4-5-1_dup1
ensemblENST00000413849