An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT080279.2

General info


NONCODE TRANSCRIPT IDNONHSAT080279.2
NONCODE Gene IDNONHSAG031995.2
Chromosomechr20
Start Site50172421
End Site50173562
Strand+
Exon Number2
CNCI Score-0.0049152
Length688
Assemblyhg38
Other transcript VersionsNONHSAT080279.1(old version)

Sequence


>NONHSAT080279.2
gtgtatcccagagctgaccctgcggcgcctttcccaggctcgcgtccggaagaacattccaacacagaccacaacacctatggacctggaaaacattgtgctcagtgaaagaagccagacacagaaggacaatgttgtatgaggtacctgggatgggcagattctgagagatggaaaatagaatagagattacctggagagaggggggaattgttgaatgaggacagagtttgtgttggggatgatggaaaagttttggatacagagagttatgacgagtatacagcattgtgaattttttttcttttctttgttttttgtgacaaggtcttattctgttgcccaggctggactgcagtggtgcaatcctagctcactgcagcttcgacctcccgtgctcaagtgattttcccacctcagcctcccgagtagctgggactacaggtgcgtgccaccacgcctggctgatttttcttgtatttttttgtagagatgggggtatcgctatgttgcccaggctggtcttgaacacttgggctcaagtaattctcccgccttggcctcccaaagtgctgggattacaggtgtgagccactgtgcctagtgtgaatgcatttaatgccactgaattgtacacttaataatggtgaaaaatataaatattctgttaaatattttaccacaataa

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00.2355510.2934120.3637320000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
0.507480.06199890.270680.4451060.03060990.1844220.468240
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0.07005790.221920.88318500.5303280.5497950.5333680
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
00000
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset