An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT080534.1

General info


NONCODE TRANSCRIPT IDNONHSAT080534.1
NONCODE Gene IDNONHSAG032134.1
Chromosomechr20
Start Site56739116
End Site56747176
Strand-
Exon Number2
CNCI Score-0.0571397
Length652
Assemblyhg19
Other transcript VersionsNONHSAT080534.2

Sequence


>NONHSAT080534.1
TGTGCATCACAGTGTCACAATGCCTGTTCTTTCACAGAGATGATGGTGCTGGAGAGATGGTTCATTTTGACCGAGGCCCGTCTGGTGGTTCGTTGCTGTGATGTATTTCGGCATCATCGACGCAGGTTCACCAGCCTCATCTCGACCTTGGAAATGTTGCGGTATTTTACAGTGTGTGGTGACATTTATGGGCCCATTTGGACACCCACAAAGAGGTTGATTTCCATAGATTAAATGTCAAGTTTGAAGCCATCCAGGGTAATTGAATCCTTGAATGTTGTCCACTTCGATTCTCAGCTGGGGCCGTTGACTGGACATTTGTGCTCTGTTACAAACTCTTGAGTGCAGCCCAAATTGCTTAATGCCAAAAGGTCACTCTGTGAGTCCAGGGGGAGGGTGTCGGTAGGGAGGACCATGGCACTGGAGTTTGATACCTGCAGAAATGTTGCCTTGTTTTTATTTCTTTAAATGAAAGCACATATGTGGTTAGTTGGTGAATACATTACCGGGGACAGAAGAAAAAAAACCCCACCAACTAAGACTTCCTAGATGTCAGTTAGTTTAAAATATCTAACCATCTATGTTTTGTCAAGAGCAAAAGGCTAAAAAGAACTTCACTGTAATGTTTTAAGTAGGAATAGTTTTAAACGGC

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
noncodeV3Human
noncodeV3n376870
PMID26117828PNCT_HSA246013
lncipedialnc-ANKRD60-1-1_dup1
PMID26117828TCONS_00024188
NONCODEv4NONHSAT080534