An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT082145.1

General info


NONCODE TRANSCRIPT IDNONHSAT082145.1
NONCODE Gene IDNONHSAG032855.1
Chromosomechr21
Start Site40400956
End Site40402611
Strand-
Exon Number2
CNCI Score-1.1122333
Length468
Assemblyhg19
Other transcript VersionsNONHSAT082145.2

Sequence


>NONHSAT082145.1
TGTGGAGGCTCAAAAGAGCAGAGCTGGGAGACCAGGGAGGATGTAGCTGCAGGAATCCCAGGAATGCAGGTGAGGGCTGGAGGCGGTTGCCCTGCAGGTGAGTGATGGGAGAGGCCAGAGGGGCCAGCGAGGTGTGGGTCTGGAGCCAGCAGATCATGTTTTCTGTCTGTCCTTCCTCCACGACGATGTACTCTTTAGGAGCCGAGTGACGATGACCTGTGGATGAGCAGCCTGGGATGCCCCTGTCCCCAGCCTCTTCAACCTGACACAAGTTTGCATTCTATGCTCTCTTTCTTTGGAACAAGGATTGACTCCTAAGTGGCATCTGGAGAAGGCCGAGCTTCCTGCAGGGACCTGAAGAGGGTTTTTAGAAACAGAAACGGAGTCATCAGATTGCTCACAGTGGCCAAATCTTGCCCTAAAGTCAAAGCTCTGAAGCACTGCACTAAAGAGCTCTTGGAACACCCG

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT082142.1
NONHSAT082143.1
NONHSAT082144.1
NONHSAT191482.1

Data Sources

Source NameOld Id
noncodeV3n377222
PMID26117828PNCT_HSA248187
noncodeV3Human
PMID26117828TCONS_00024897
lncipedialnc-PSMG1-4-1_dup1
NONCODEv4NONHSAT082145