An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT082149.1

General info


NONCODE TRANSCRIPT IDNONHSAT082149.1
NONCODE Gene IDNONHSAG032858.1
Chromosomechr21
Start Site40499493
End Site40499966
Strand+
Exon Number1
CNCI Score-0.3178511
Length473
Assemblyhg19
Other transcript VersionsNONHSAT082149.2

Sequence


>NONHSAT082149.1
AGACAGTGCTGAAAGCGAAGAAAGAAGTTCCTGCCCCTCCTAAAGCCAAAGCCAAAGCAAAGGCTTTAAAGGCCAAGAAGGCAGTGTTGAAAGGTGTTCACAACCACAAAAAAAAGAAGATCCACACGTCCCCCACCTTCCGGCGGCCCAAGACACTGCAACTCCGGAGGCAGCCCAAATATCCTTGGAAGAGCACCCCCAGGAGAAACAAGCTTGACCACTATGCTATCATCAAGTTTCCGCTGACCACTGAGTCGGCCATGAAGAAGACAGGAGACAATAACACACGTGTGTTCATGGTGGATGTTAAAGCCAACAAGCACCAGATCAAACAGGCTGTGAAGAGGCTCTATGATATTGACATGATCAAGGTCAACACCCTGATTTGGCCTGATGGAGAGAAGAAGGCATATGTTCCACTGGCTCCTGATTACGATGCTTTGGATGTTGCCAACAAAATTGGGATCATCTAA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT082150.1

Data Sources

Source NameOld Id
ensemblENST00000467573