An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT082949.1

General info


NONCODE TRANSCRIPT IDNONHSAT082949.1
NONCODE Gene IDNONHSAG033073.3
Chromosomechr21
Start Site45299907
End Site45300897
Strand+
Exon Number2
CNCI Score-0.0684032
Length609
Assemblyhg38
Other transcript VersionsNONHSAT082949.1(old version)

Sequence


>NONHSAT082949.1
AGCCGGGACTGAACAGCTGCCAGTGCGCAGCCTGGGTGGGGGCTCAGGACAAGGGGCTCTTATGGAGCCCCTCGAGACCCCCAGGAGGTGGACACTGCCCCCAGCTCTTGGTGGAGCCCTTGGGCTGCAACAGCAGGAACTGAACCCCAGGGGCTTTGGGGTTAAGAGAAGAATGTCTGGACGTTAGCGGCAAAAGCAGGCGGGTGGGGCAGTGAGCACAAGCGGGGGTGCCCCTGATACTGGCTACCCCTCCACATCTATCTCTGTCCGGGTCTGCCTCTGTCCTCGGCACACGGCACGCGCTGCTCCGGGGGCGGCCGCGCCACAGGTGAGCGGAACACGGTTCGAGGAAGGTGGGCCGGGCACAGGGCGGCCCGTGGTTGCAGGTACCAGAGCTTGCTGGAGCTGGCTGGGCTTTGAGGATCAATCACCTGGTTCTGCAGATGTAGAAGTATGTAAAGTAATCAGCACTTTCACCAGGGCAGGACTCGGATCCAGGCCAGCAGCTGCCCAGCCCAAGGCTCCTTGCACCACCGTGTGAGCCACATACTTTCCGGATAGGAGAAGGTCCAGAAGGTGAAGTCTGCGCCCAGGACCTGCAGAGCCCCC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT191079.1
NONHSAT191080.1
NONHSAT191081.1
NONHSAT244366.1
NONHSAT244367.1
NONHSAT244368.1
NONHSAT244369.1
NONHSAT244370.1
NONHSAT244371.1
NONHSAT082932.2
NONHSAT082933.2
NONHSAT082934.2
NONHSAT082936.2
NONHSAT082937.2
NONHSAT082938.2
NONHSAT082939.2
NONHSAT082940.2
NONHSAT082941.2
NONHSAT082944.2
NONHSAT082945.2
NONHSAT082946.2
NONHSAT082947.2
NONHSAT082951.2

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA249041
lncipedialnc-ADARB1-3-16_dup1
noncodeV3n377192
PMID26117828TCONS_00024854
noncodeV3Human
NONCODEv4NONHSAT082949