An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT084375.1

General info


NONCODE TRANSCRIPT IDNONHSAT084375.1
NONCODE Gene IDNONHSAG033532.2
Chromosomechr22
Start Site24686174
End Site24686504
Strand+
Exon Number1
CNCI Score-0.0667648
Length330
Assemblyhg38
Other transcript VersionsNONHSAT084375.1(old version)

Sequence


>NONHSAT084375.1
GGAGACTGTTCGATCACCAGGAGCACAAAGTTATCATTGTTGGGCTGGATAATGCAGGGAAAACTACCATTCTTTACCAGTTTTCTATGAATGAGGTTGTACATACATCTCCTATAATAGGAAGTAATGTAGAAGAGATAGTGATTAATAATACGCGTTTCCTAATGTGGGATATTGGTGGCCAAGAATCTTTTCGTTCTTCCTGGAACACTTACTATACTAACACAGAGTTGATAATAGTTGTGGACAGTACAGACACATGATTTCTGTAACTAGAGAAGAACTCTATAAAACGTTAGCGCATGAGGACCTAAGGAAAGCTGGATTGCT

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-GGT1-3-1_dup1
NONCODEv4NONHSAT084375
ensemblENST00000430731