An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT090947.1

General info


NONCODE TRANSCRIPT IDNONHSAT090947.1
NONCODE Gene IDNONHSAG035638.1
Chromosomechr3
Start Site103781882
End Site103782426
Strand+
Exon Number1
CNCI Score-0.0469477
Length544
Assemblyhg19
Other transcript VersionsNONHSAT090947.2

Sequence


>NONHSAT090947.1
GAGTATAAGCTAGTCGTTCTGGGCTCAGGAGGCATTCGAAAGTCTGCTCTGCCTTTACAATTTGTCCAAGGAAATTATGTTGAAAATTATGATCCTATGATAGAAGATTCGTACAGAAAGCAACTTGAAATAGATGCACAACAGTGTGTGCTTGAAATCTTGGATACCACAAAAACAGAAAAATCTTCAGCAATGAGGGATTTGTACATGCAAAATAAACAAGGCTTTGCATTAGTTTATTTCATCATAGCACAGTGCACATTTAATGATTTTCAACATCTAAGAGAAAAGATTCTTCAAGTTAAAAACATTGATGATGTTCCAATGATTCTGGTCGGTAATAATTGTGACTTGGAAGATGAAAGAGTTGTAGAAAAGGAACAAGGTCAAAATCTAACAAGACAGTGGGCCAACACTGCATTCTTATAATCTTCTTCAAAATTACAAGTAAATGTTAATTAGCTATTTTATTACCCAGTGCAACAAATTAACAGAAAAACTCTAGTGCCTGGAAGGCTTGGAAAAAGTCATGTCAGCTGGTTTA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT090947
ensemblENST00000478270
lncipedialnc-ALCAM-18-1_dup1