An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT092125.1

General info


NONCODE TRANSCRIPT IDNONHSAT092125.1
NONCODE Gene IDNONHSAG036087.2
Chromosomechr3
Start Site130918225
End Site130919120
Strand-
Exon Number2
CNCI Score-0.0081920
Length572
Assemblyhg38
Other transcript VersionsNONHSAT092125.1(old version)

Sequence


>NONHSAT092125.1
AAATGCCTGCGTGGAGAGGTGGAAACAAGTGTGGGGTCTGCGGGAGGGCCGTGCACCACGCAGAAGAGGTGCAGTGTAATGGCAGGAGCTTCCATGCTGCTTTCTATGCATGATTTGCAGGAATAATTTAGATAGCAAGACAGTGGCAATTCATGATTAAGAGATTTACTGCAAATCCTGCTATGGAAAGAAGTATGGGCCAAAAGGCTACAGTTTATGGCCAGGGCGCTGGCATACTTAACATGGACCGTGGTGAGAGCCTGGGCATCAAGCCAGAGTGTTCAGCCTCACATGCCTACAAGCAAATCCAAAGACTTCTAAATTTGCTCAGAAATACAGAGGTGCTGAGAAGTGTTCCAGATGTGGGGATTCCGTACATGCTGCTGAGAAGGTAACTGGAGCTGGAAAGCCCTGGAACAAAAACTATTTCCGATGTGCAAAGTGTGGGAAGAGTCTTGAATCAACAACTCCTGACTGAAAAAGAAGGTGAAATCTATTGTAAAGGGTGCTATGCAAAGAACTTTGGGCCCAAGGGATTTGGCTATGGCCAAGGAGAGGGCTCTTGTTCATGC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000506407
NONCODEv4NONHSAT092125
PMID26117828PNCT_HSA081915
lncipedialnc-ASTE1-6-1_dup1