An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT092884.1

General info


NONCODE TRANSCRIPT IDNONHSAT092884.1
NONCODE Gene IDNONHSAG036487.1
Chromosomechr3
Start Site156807669
End Site156817945
Strand+
Exon Number3
CNCI Score-0.1088592
Length571
Assemblyhg19
Other transcript VersionsNONHSAT092884.2

Sequence


>NONHSAT092884.1
AGAAAGTGCTAGGCACGTAGGCGTTCAGGAGACAGTCACGGTACTCGTTTCCAGACAGAAGTCATGAGGAACAAGAGGGAAGGTGCTTTCCCGTGTGCAGCGCTTGGGGAGACTCACACAGACAGAGGATCTGGCATGACAGGGAAAGGAGGAAATGGCTTCTGTTAATCTCTCCTTCAGCTTCTCCCGCCCTTCCCATGCACTCTTCCTGTTTCCCTTTCCAGTTCTCACGGTGACTCAAGGAACAACGTGTGAAATGAAAGACCTCAGGTGCTGTATTGGCTCTTGACAGCTCTTCAGAAGAAAATACCTCCTGCCTGTTCTGTTCAGTCCTGGTGCAGCTTCCAGGAAGCCAAATGACCCACCGGCTTACCCACATCGCAGGAAGCTTTGGAGCAGAGTCAGTGACTATGTGAACCTGCCTCAACCTCTGCTCCCTGGTTCAGCATTTGGCTTGGGAAAAATGACACTATTTCCTGTCTCTTAAACATTATTTCAAGGCACAGGTCTTCCACCATTCTGAGAGGCAGGGGGATCTTTGAGTTCTGCCAGGAGCTGGGGGTTAGGGGTA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT092881.1
NONHSAT092882.1
NONHSAT092883.1
NONHSAT092885.1
NONHSAT092886.1
NONHSAT194734.1

Data Sources

Source NameOld Id
gencodeENST00000474477.4
noncodeV3Human
ensemblENST00000474477
PMID26117828PNCT_HSA261758
PMID26117828TCONS_00026206
lncipedialnc-LEKR1-2-3_dup1
NONCODEv4NONHSAT092884
noncodeV3n366001