An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT093902.1

General info


NONCODE TRANSCRIPT IDNONHSAT093902.1
NONCODE Gene IDNONHSAG036945.1
Chromosomechr3
Start Site187715209
End Site187721778
Strand-
Exon Number2
CNCI Score-0.3039370
Length427
Assemblyhg19
Other transcript VersionsNONHSAT093902.2

Sequence


>NONHSAT093902.1
AGGACAGTAATGCTTCCAAGCTAGAGGCATTCAAGGAGTGGCCCAGAGAACATGTCATTCAGGGCCTGGAAGATTTCCATCAGCATTCAGGTTCTGCAGGGGATGGGGATGCTGAGTAAGTGAGACACGTTTCTACAGCTTCTAGCCTGCCCAGTGCCTGCAATGACATCGCTGTTGCTGATGAAGACTTACTGTTCTCAAGTGCTTATCACACTGGGAGGATGGCAACTGGGCAAAGCAGACACAGAAGGACATCATGCTGCTGACTCGTGGCTTCAGACTCTCAGTCTCCTGTATTCCTTCCTCCTGCAATTGCAGGGGGTGCACAAAACATTTGCAGGCATGAACGCAGTGAAGCAAATAGTTGTTCTTAGGAACAATTTCCCTTGGAGTCTTTCACAGACACCTGGAGCAAACTGGTGCTCAG

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
noncodeV3Human
gencodeENST00000415940.1
PMID26117828PNCT_HSA262677
NONCODEv4NONHSAT093902
PMID26117828TCONS_00026626
lncipedialnc-BCL6-5-1_dup1
ensemblENST00000415940
noncodeV3n366156