An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT095490.1

General info


NONCODE TRANSCRIPT IDNONHSAT095490.1
NONCODE Gene IDNONHSAG037479.2
Chromosomechr4
Start Site10254925
End Site10256621
Strand-
Exon Number1
CNCI Score-0.0057344
Length1696
Assemblyhg38
Other transcript VersionsNONHSAT095490.1(old version)

Sequence


>NONHSAT095490.1
ATGGAGCACACATGGAGCTTGAAGAACAAGCAGCAAGGGTTCTGTATTCTAAGCCTTGGAGTTTTATGGCTCTAGCTACATCTGCCTTACAATTGTTCAACCATTTATCTATCAGCACCAGGCATCAGACGACAGCAAATTCAGATTCTTCTAAGGCAGGCAGCACTGTTTTCTTGCCAATAAGCAAAGAACAGTGGTCAGTGTGCAAAGCAGAAGGAGCTCATGTGGCTGCCTCGTGAAAGCACTCAAGGTGAGAGGCTGCAACCACAGTGCTGTGTTCAGACTTAATGGACACGAGGGTAAAAAGGCATTTATATTGGAATACTGATGCTGCCTGATGGGGGAAGAGCTTCAGGTAGATTTCCTGAGTCATGTTCCCCTTACAACACACAACTTTGCTCAGAAGACACTCCTGAAGTTTACCTTTTGTAACATCAGAAATTCCTGCTAAGTGGATTTCAGCATCATGCTCGTGGCTACAAGTTTCATGAGCACTATAGCACTAAAGTACCCACTAGGCACGTGGGCTGGAGTAATATCGGACAATTCATTTCCAAACTGGCTACAGTGAGGTCCCAGCACTACCTTCTTTGACAATGTATCATACGTGACAGTCTTTCCTGGATGCCTGTTAGCTCCCAACAGACATTCTACACCTCATGCTTTCATATTCAATTCCTTCAGCCCCTCTGAAGGTTTCCTCTCCCAGAGAGAGGGGTCAACATCTACGCTTCATGTCCACGTGATCAGCATCACCACACCTGTGGACAGGAGGATGATTGAGGATGCAACACCAAGTCACAGTCAATCTGCCTTCCCTTCACAGCCCTACCCCAGTGGTTCCAGCCACCTCAGCCCAGTGAGCTGGTCCACAACCCAAACCCCTGTGCCAGCACACAAGGAAAGTCACTGAGCTCTGGGATCCAGGAGAAAAAAACGTTAGACCTCATGGACAGATCCATGTTCTTCTGGGGAAATACAAGCCCATATAGTGGCACGCTCTGCTTAGATCAGGTCAGGCTCTATCAGAACTGTTTCAGGTTAAGTGGCAGAGGCAATGCAGTCAAGATCCTCCAAGGTTGTCAACCTGACCCCCAGAGCAGTTCCAGGCCTTCAGAGATGAGGTGGCTGTCCTGAGCAGTGTAGGACATGTGGACATTCTGCTCTTGTTGGGGTTCATGACACAGGACAACCTGGCATTGTGACCCAGTGCTGTGAAGGCAGCCTCTACAGCTACCTGCATGTCCAGGAGACCAAGTTTCAGACATTCCAGCTAATTGACATTGCCTGGTAGACAGCTCAGGGAAGGGACTAGTTGGCATGCAGAGAAGATCATCCACAGAGACATAAAATCCAACATATTTCTCCATGAAGGCCTCATGGTGTGAACTAGAGACATTTTGGTTTGGCAACAGTGAAGTCACACCGAAGTGATTCTCAGCAGATTAAGGAAACCCACAGGCAATGGCCCCAGAGGCGATCTGAACGAAGGGTAAAAACCCACTCAGCTTCCAGTCCCATGTCAATGCCTATGGCATCTCATTTTATGAGCTGATGGGAGGGGCACTTCCTTTCTCCCACATCAACAACCCCGACCAGATTATCTTCTTGACAGGCTGGGGGTATCCCCCCATTCCTAGATCTTAGCAAGATACACAAGAACTGCCCGAAAGCAATGAAGAGGCTGGTAGCTGAC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT095490
lncipedialnc-WDR1-9-1_dup1
ensemblENST00000508566