An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT096628.2

General info


NONCODE TRANSCRIPT IDNONHSAT096628.2
NONCODE Gene IDNONHSAG038052.2
Chromosomechr4
Start Site62291561
End Site62292337
Strand+
Exon Number2
CNCI Score-0.0491520
Length353
Assemblyhg38
Other transcript VersionsNONHSAT096628.1(old version)

Sequence


>NONHSAT096628.2
GTGATGGACAAGCCTCCACATGATAAGGGGGGCCTTCAGGATCAAAACCAACTTTCCCACAGAGTACTCATTCAAACCACCAAAGATCACATTTAAAACAAAGACCTATCACCTGAACATTGATGAAAAGGGGAAGGTCTGTTTGCCAGTAATTAGTGCTGAAAACTAGAAGCTGGCAACCAAAACCAACTAAGTAATCCAGTCAGTCTTTCATAGCACTGATGATCTATCCTCAGCCCAAGCATCCCCTTTGGCCTGACTTACCTGAAGAATACTCTAAGGATCATAAAAAATTCTGTAAGAATGCTGGAGAGTTTACAAAGCAATACAGTCAAAAGCGACTTGCAGACTAA

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00000000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000000
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00007.2538
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
17.62130021.83370
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA086664
lncipedialnc-LPHN3-10-1_dup1
NONCODEv4NONHSAT096628
ensemblENST00000509121