An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT096734.1

General info


NONCODE TRANSCRIPT IDNONHSAT096734.1
NONCODE Gene IDNONHSAG038103.2
Chromosomechr4
Start Site68537414
End Site68647417
Strand+
Exon Number2
CNCI Score-0.0327680
Length524
Assemblyhg38
Other transcript VersionsNONHSAT096734.1(old version)

Sequence


>NONHSAT096734.1
TATTTTTCATAGCTTAAAAATCATTGACATAGAATAATTCCAACTAAAGTACGTATTAAATCCCTGGAAAATAAATTTTGTCTTAACAAGGTAAGTTGTGAAAAGATGTTTTGTCACAGGAAAAAGGAAATCCTCCATTTAAAACCCTCCATGCTGAAATAAAGGAGGAGTCCCATCTTTCAGTCATTCCACTTCAGGCTTTTGATATAACTAATCTCTTTTCTTCTTCTTTCCTTTTTTGGCAAGCTTTCGGAAACAAAACAGGCAAAATTTTGTGATGATAAATATCACAGTTGCCACGCAGGCCAGCAGGAATGCTATCACATCCAAAGAGTGGTACTGGATCCAGGTGAGGTTGTGAGCTGCGACTCGAAGGTGCTTGGCTCCTTTGTGGCGCATGACAAACTCAATCCAGAAGACTGCTCGATCCAGGGGCTTCATTGGTTGGTCATGATGAATTCTTGATAATTTCATGACATTCTCTTTATAGCTGAAGGATAAATATAAAGATATCAACATTAAAA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT096734
PMID26117828PNCT_HSA086805
lncipedialnc-TMPRSS11E-3-1
PMID26117828TCONS_00028936