An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT097120.1

General info


NONCODE TRANSCRIPT IDNONHSAT097120.1
NONCODE Gene IDNONHSAG038299.1
Chromosomechr4
Start Site80584914
End Site80617991
Strand+
Exon Number4
CNCI Score-0.1609164
Length741
Assemblyhg19
Other transcript VersionsNONHSAT097120.2

Sequence


>NONHSAT097120.1
tgccatgaggactagaaacctggaaacctacgtttcccagctactccatctccccacaccgcaggctttctgttatgttctgatgatgaactactgcaggaacatatcaggaaagccaagagaatccacagaccctttgaaggaactgtaccacccctgcagactccctgagatgccaaaaactgtgaatctgcttgctttctcaactgggaggctcatggtctgggcttaactcccacttataagtgaaaatacgtaatggtctccaactccatccaggtgtctgtgaatgccattatttcattcctttatataggttccccagtgaggattgtcaggcctctgagcccaagctaagccatcatatcccctgtgacctgcacgtatacatccagatggcctgaagcaactgaagatccacagaagaagtgaaaatagccagttcctgccttaactgatgacattccaccattgtaatttgttcctgccccaccctaactgatcaattgactttgtgacaatacaccctccctacccttgcggtaatgtaatttgtgatattccctcacccttgtgaaggtactttgtactatacaccctccccacccttgagaaggtactttgtaatattctcccctgcccttaggaatgtactttgtaagatccaccccctgcccacaaaaaattgctcctaactccaccgcctatcccaaacctgtaagaactaatgataatcccacc

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT097119.1

Data Sources

Source NameOld Id
NONCODEv4NONHSAT097120
gencodeENST00000506460.1
lncipedialnc-PRDM8-2-1_dup1
PMID26117828PNCT_HSA267113
noncodeV3Human
ensemblENST00000506460
noncodeV3n366865
PMID26117828TCONS_00028333