An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT097860.1

General info


NONCODE TRANSCRIPT IDNONHSAT097860.1
NONCODE Gene IDNONHSAG038660.1
Chromosomechr4
Start Site113486143
End Site113486554
Strand+
Exon Number1
CNCI Score-0.0674688
Length411
Assemblyhg19
Other transcript VersionsNONHSAT097860.2

Sequence


>NONHSAT097860.1
ATGGCTCGTACAAGGCAGACTGCCCACAAATCAACCGGTGGTAAACCACCCAGGAAGCAACTGGCTACAAAAGCCGCTCGCAAGAGTGTGCCCTCTACTGGAGGGGTGAAGAAACCTCATCGTTACAGGCCTGGTACTGTGGCGCTCCGTGAAATTAGATGTTATCAGAAGTCCACTGAACTTCTGATTCGCTAACTTCCCTTCCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTTAAAACAGATCTGCACTTCCAGAGCGCAGCTATCGGTGCTTTGCAGGAGGCAAGTGAGGCCTATCTGGTTGGCCTTTTTGAAGACACCAACCTGTGTGCTATCCATGCCAAACGTGTAACAATTATGCCAAAAGACATCCAGCTAGCATGCCACATACGTTGAGAATGTGCTTTA

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
NONCODEv4NONHSAT097860
lncipedialnc-LARP7-4-1_dup1
ensemblENST00000321285