An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT097885.1

General info


NONCODE TRANSCRIPT IDNONHSAT097885.1
NONCODE Gene IDNONHSAG038671.2
Chromosomechr4
Start Site112788082
End Site112788878
Strand-
Exon Number1
CNCI Score-0.1712128
Length796
Assemblyhg38
Other transcript VersionsNONHSAT097885.1(old version)

Sequence


>NONHSAT097885.1
ATGCTGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTCCGGCCCCTGCTGTCGTGAAGAAGCAGGAGGCTAAGAAAGTGGTGAATCCCCTGTTTGAGGAAAGGCCTAAGAATTTTGGCATTGGACAGGACATCCAGCCCAAAAGAGACCTCACCCGCTTTGTGAAATGGCCCCGCTATATCAGGTTGCAGCAGCAGAGAGCCATCCTCTATAAGCGGCTGAAAGTGCCTCCTGCGATTAACCAGTTCACCCAGGCCCTGGACCGCCAAACAGCTACTCAGCTGCTTAAGCTGGCCCACAAGTACAGACCAGAGACAAAGCAAGAGAAGAAGGCTGTTGGCCCAGGCCGAGAAGAAAGCTGCTGGCAAAGGGGACGTCCCCACCAAGAGACCACCTGTCCTTTGAGCAGGAGTTAACACCGTCACCACCTTGGTGGAGAACAAGAAAGCTCAGCTGGTGGTGATTGCACCCGACGTGGATCCCATCGAGCTGGCTGTCTTCTTGCCTGCCCTATGTCGTAAAATGGTGGTCCCTTAGTGCATTATCAAGAGGAAGGCAAGACTGGGACGTCTCGTCCACAGGAAGACCTGCACCACTGTCGCCTTCACACAGGTGAACTCGGAAGACAAAGGCGCTTTGGCTAAGCTGGTGGAAGCTATCAGGACCAATTACAATGACAGATACGATGAGATCTGCCGTCACTGGGGTGGCAACATCCTGGGTCCTAAGTCTGTGGCTCGCATTGCCAAGCTCGAAAAGGCAAAGGCTAAAGAACTTGCCACTAAACTGGGTTAA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT097885
lncipedialnc-C4orf21-8-1
ensemblENST00000482859