An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT097885.1

General info


NONCODE TRANSCRIPT IDNONHSAT097885.1
NONCODE Gene IDNONHSAG038671.1
Chromosomechr4
Start Site113709238
End Site113710034
Strand-
Exon Number1
CNCI Score-0.4187414
Length796
Assemblyhg19
Other transcript VersionsNONHSAT097885.2

Sequence


>NONHSAT097885.1
ATGCTGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTCCGGCCCCTGCTGTCGTGAAGAAGCAGGAGGCTAAGAAAGTGGTGAATCCCCTGTTTGAGGAAAGGCCTAAGAATTTTGGCATTGGACAGGACATCCAGCCCAAAAGAGACCTCACCCGCTTTGTGAAATGGCCCCGCTATATCAGGTTGCAGCAGCAGAGAGCCATCCTCTATAAGCGGCTGAAAGTGCCTCCTGCGATTAACCAGTTCACCCAGGCCCTGGACCGCCAAACAGCTACTCAGCTGCTTAAGCTGGCCCACAAGTACAGACCAGAGACAAAGCAAGAGAAGAAGGCTGTTGGCCCAGGCCGAGAAGAAAGCTGCTGGCAAAGGGGACGTCCCCACCAAGAGACCACCTGTCCTTTGAGCAGGAGTTAACACCGTCACCACCTTGGTGGAGAACAAGAAAGCTCAGCTGGTGGTGATTGCACCCGACGTGGATCCCATCGAGCTGGCTGTCTTCTTGCCTGCCCTATGTCGTAAAATGGTGGTCCCTTAGTGCATTATCAAGAGGAAGGCAAGACTGGGACGTCTCGTCCACAGGAAGACCTGCACCACTGTCGCCTTCACACAGGTGAACTCGGAAGACAAAGGCGCTTTGGCTAAGCTGGTGGAAGCTATCAGGACCAATTACAATGACAGATACGATGAGATCTGCCGTCACTGGGGTGGCAACATCCTGGGTCCTAAGTCTGTGGCTCGCATTGCCAAGCTCGAAAAGGCAAAGGCTAAAGAACTTGCCACTAAACTGGGTTAA

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
NONCODEv4NONHSAT097885
lncipedialnc-C4orf21-8-1
ensemblENST00000482859