An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT098858.1

General info


NONCODE TRANSCRIPT IDNONHSAT098858.1
NONCODE Gene IDNONHSAG039156.2
Chromosomechr4
Start Site154586678
End Site154590749
Strand-
Exon Number5
CNCI Score-0.0450560
Length808
Assemblyhg38
Other transcript VersionsNONHSAT098858.1(old version)

Sequence


>NONHSAT098858.1
TGGCAGCAATCCTTTCTTTCAGCTGGAGTGCTCCTCAGGAGCCAGCCCCACCCTTAGAAAAGATGTTTTCCATGAGGATCGTCTGCCTGGTCCTAAGTGTGGTGGGCACAGCATGACTGCAGATAGTGGTGAAGGTGACTTTCTAGCTGAAGGAGGAGGCGTGCGTGGCCCAAGGGTTGTGGAAAGACATCAATCTGCCTGCAAAGATTCAGACTGGCCCTTCTGCTCTGATGAAGACTGAACTACAAATGCCCTTCTGGCTGCAGGATGAAAGGGTTGATTGATGAAGTCAATCAAGATTTTACAAACAGAATAAATAAGCTCAAAAATTCACTATTTGAATATCAGAAGAACAATAAGGATTCTCATTCGTTGACCACTAATATAATGGAAATTTTGAGAGGCGATTTTTCCTCAGCCAATACCGTGATAATACCTACAACCGAGTGTCAGAGGATCTGAGAAGCAGAATTGAAGTCCTGAAGCGCAAAGTCATAGAAAAAGTACAGCATATCCAGCTTCTGCAGAAAAATGTTAGAGCTCAGTTGGTTGATATGAAACGACTGGAGTGGACATTGATATTAAGATCCGATCTTGTCGAGGGTCATGCAGTAGGGCTTTAGCTCGTGAAGTAGATCTGAAGGACTATGAAGATCAGCAGAAGCAACTTGAACAGGTCATTGCCAAAGACTTACTTCCCTCTAGAGATAGGCAACACTTACCACTGATAAAAATGAAACCAGTTCCAGACTTGGTTCCCGGAAATTTTAAGAGCCAGCTTCAGAAGGTACCCCCAGAGTGGAAGGCA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT098858
PMID26117828PNCT_HSA269551
lncipedialnc-FGG-2-1
noncodeV3n336972