An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT098860.1

General info


NONCODE TRANSCRIPT IDNONHSAT098860.1
NONCODE Gene IDNONHSAG039157.2
Chromosomechr4
Start Site154608507
End Site154609691
Strand-
Exon Number2
CNCI Score-0.0004096
Length204
Assemblyhg38
Other transcript VersionsNONHSAT098860.1(old version)

Sequence


>NONHSAT098860.1
AGCAATTCTTAGTCTACTGTGAAATCGATGGGTCTGGAAATGGATGGACTGTGTTTCAGAAAGACTTGATGGCAGTGTAGATTTCAAGAAAAACTGGATTCAATATAAAGAAGGATTTGGACATCTGTCTCCTACTGGCACAACAGAATTTTGGCTGGGAAATGAGAAGATTCATTTGATAAGCACACAGTCTGCCATCCCATA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-FGA-1-1
NONCODEv4NONHSAT098860
noncodeV3n335732
PMID26117828PNCT_HSA269553