An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT099109.1

General info


NONCODE TRANSCRIPT IDNONHSAT099109.1
NONCODE Gene IDNONHSAG039272.2
Chromosomechr4
Start Site165664349
End Site165665671
Strand+
Exon Number3
CNCI Score-0.0696320
Length1045
Assemblyhg38
Other transcript VersionsNONHSAT099109.1(old version)

Sequence


>NONHSAT099109.1
TCCACCTGTTCTGTGAAGACAAGGGGCAGCTCATCTGCTGGCACTGTGAGCGGGCACCGCAGCACAAAGGGCACACCACAGCTCTTGTTGAAGACGTATGCCAGGGCTACAAGGAAAAGCTCCAGAAAGCTGTGACAAAATTGAGGCAACTTGAAGAGGAGTGCACAGAGCAGAAGGTGTTCACAGCAATGCACATAACTAAATGAGAAGACACAAATTCAGAGACAAAAAAATCGTTTGACTTTAAGAATCTCCAGAGTTTCCTACATGAGGAGAAGAAGTCTTATCCCTGGAGACAGGAGAAGGAAGAACGATAGACTCTGAATAGACTGAGGGACCATGGGACCAGTCTGGGGCTGAATTCAAGAGCCACATGCTGGAACTGGAGGAAAAATGTCGGGGCTCAGCCCAAAAATTGCTGCAGAATGTGAATGATACTGTGGGCAGGAGTTGGACTGTGAAGCTGGAAACATCAGAGGCCTTCTCCTTAGAGCTTCATACTATGTGCAACATTTTTGAGCTTTATTGACTCTGGATCCAGATACAGCTCATAGTGAACTAATTCTGTATGAGGATTGGAGAAAAGTGACTTGTGGATATCCCCAGGACCATCACAGCACTTCTTCCAGGAGATTTAGTGCCTTCCCCTGTGTCCTGGGTTGTGAGGGCTTCACCTCTCAGGAAGATGCTCCTTCAAAATGGATGCTGGAAAACGAACCAGGTGGGATTTAGGAGTTTGTATGGCAATATGCAGAGGTGCACTGACATGAAGCAAGAGCCTCAGTCTGGATTCTGGAACCTCGGACTATGCCAAAAGAAAGGCTATGTAGCCCTTACATCTCCCTTAACTTCCCTTCATATGTGTGAGCAGCCCTTGGTTGTGGGAGTGTTTCTGGACTCTGAGGCTGGAGTTGTATCCTTTTACAACATGAGTACTGGCTACCACATCTTCACCTTCCCAAAGGCTTCCTTCTCTGATACTATCCGGCCCTATTTCCAGGTTTATCAATATTCTCCTTTGTTCCTGCCTCCCCCAGATGGTTAA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT099109
PMID26117828PNCT_HSA089860
ensemblENST00000509326
lncipedialnc-CPE-3-1