An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT101518.1

General info


NONCODE TRANSCRIPT IDNONHSAT101518.1
NONCODE Gene IDNONHSAG040411.2
Chromosomechr5
Start Site55944629
End Site55945028
Strand+
Exon Number1
CNCI Score-0.0274432
Length399
Assemblyhg38
Other transcript VersionsNONHSAT101518.1(old version)

Sequence


>NONHSAT101518.1
GCCATTTTTTTGGAAACCTCGGCGCCATGAGAGCCAAGTGGAGGAAGAAGCGAATGCGCAGGCTGAAGCGCAAAAGAAGAAAGATGAGGCAGAGGTCCAAGTAAACCGCTAGCTTGTTGCACCGTGGAGGCCACAGGAGCAGAAACATGGAATGCCAGACGCTGGGGATGCTGGTACAAGTTGTGGGACTGCATGCTACTGTCTAGAGCTTGTCTCAATGGATCTAGAACTTCATCGCCCTCTGATCGCCGATCACCTCTGAGACCCACCTTGCTCAAAAACAAAATGCCCATGTTGGTCCTCTGCCCTGGACCTGTGACATTCTGGACTATTTCTGTGTTTATTTGTGGCCGAGTGTAACAACCATATAATAAATCACCTCTTCCGCTGTTTTAGCTG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-IL31RA-2-1_dup1
NONCODEv4NONHSAT101518
ensemblENST00000597044