An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT103900.1

General info


NONCODE TRANSCRIPT IDNONHSAT103900.1
NONCODE Gene IDNONHSAG041605.2
Chromosomechr5
Start Site135247045
End Site135247815
Strand-
Exon Number2
CNCI Score-0.0438272
Length489
Assemblyhg38
Other transcript VersionsNONHSAT103900.1(old version)

Sequence


>NONHSAT103900.1
CAGCCCTCTTGCCTGAGCAATCTGACGCAGAGGCACATGAGGAATCAGCACGGAACCATCGACCCACAGGGTTAATCCCAATGTCAATACCTGCTAGATGTCAGGGATCCCCTGGGCTGCTGGCGAGCCATTTGAAATGACCCATCTCCTGCCACCTTGGCCTGCTCCTCTGGGCCACCTCTCTCCACCTGCACTTGCTTACCGGAAGACGGCAAGGCCACCGGTGCACTTCGCAGTGCCAGGAGAAAGGCGCCTCATGCTATTAGCTCAAATAAGGAAAATCATGCCGGGAAGATTGAATTTTCTGCAGACTTGTTTAACCTGGTGATTTCTGAGCACTTGGCGCTGGCAGCCACGGGGGAGTGGGCTGCCAGCCGGCACTTTATCAGCCACTTCTCAGGACTATTCCTAAGCTTATTAAATCAGCATGAGTCACTCCCTTGCCTTCCTCACAAGCATGAATCACGAATCATCAAAACCCAAGCAAAA

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT103899.2

Data Sources


Source NameOld Id
gencodeENST00000555344.1
lncipedialnc-CTC-349C3.2.1-1-3_dup
NONCODEv4NONHSAT103900
PMID26117828PNCT_HSA095588
ensemblENST00000555344