An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT103900.1

General info


NONCODE TRANSCRIPT IDNONHSAT103900.1
NONCODE Gene IDNONHSAG041605.1
Chromosomechr5
Start Site134582735
End Site134583505
Strand-
Exon Number2
CNCI Score-0.1078981
Length489
Assemblyhg19
Other transcript VersionsNONHSAT103900.2

Sequence


>NONHSAT103900.1
CAGCCCTCTTGCCTGAGCAATCTGACGCAGAGGCACATGAGGAATCAGCACGGAACCATCGACCCACAGGGTTAATCCCAATGTCAATACCTGCTAGATGTCAGGGATCCCCTGGGCTGCTGGCGAGCCATTTGAAATGACCCATCTCCTGCCACCTTGGCCTGCTCCTCTGGGCCACCTCTCTCCACCTGCACTTGCTTACCGGAAGACGGCAAGGCCACCGGTGCACTTCGCAGTGCCAGGAGAAAGGCGCCTCATGCTATTAGCTCAAATAAGGAAAATCATGCCGGGAAGATTGAATTTTCTGCAGACTTGTTTAACCTGGTGATTTCTGAGCACTTGGCGCTGGCAGCCACGGGGGAGTGGGCTGCCAGCCGGCACTTTATCAGCCACTTCTCAGGACTATTCCTAAGCTTATTAAATCAGCATGAGTCACTCCCTTGCCTTCCTCACAAGCATGAATCACGAATCATCAAAACCCAAGCAAAA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT103899.1

Data Sources

Source NameOld Id
gencodeENST00000555344.1
lncipedialnc-CTC-349C3.2.1-1-3_dup
NONCODEv4NONHSAT103900
PMID26117828PNCT_HSA095588
ensemblENST00000555344