An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT105101.2

General info


NONCODE TRANSCRIPT IDNONHSAT105101.2
NONCODE Gene IDNONHSAG042228.2
Chromosomechr5
Start Site172016532
End Site172016932
Strand+
Exon Number1
CNCI Score-0.0004096
Length400
Assemblyhg38
Other transcript VersionsNONHSAT105101.1(old version)

Sequence


>NONHSAT105101.2
taaaaaaataattttgctgagagattactatgtaatttttgacataataacttggaaagcatccaaaaaagttgagtagcatcgctataagacaactttcattcatatatgaacaagtcttctaagtattgatatggtttggatctgtgtcctcacccaaatgtcatgctcaattgtaatcccaaatgttggaggtagggcctggtgggaggtattggatcatgggggtggattcttcatgaatggtttagcactaacccttcggtgatatagagttttcctgagatctggttaagtgtgtggcagctcccctctctcttcctcctgctctggcagtgtaagacacctcctctcccttagtcttctgccatgactgtaagtttcctgagaccttcctgga

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
0000.2121830000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000000
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00.5037080010.7089
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
10.02130016.03770
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-EFCAB9-1-1_dup1
NONCODEv4NONHSAT105101
PMID23818866FPKM1_group_26750_transcr