An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT114000.1

General info


NONCODE TRANSCRIPT IDNONHSAT114000.1
NONCODE Gene IDNONHSAG044366.2
Chromosomechr6
Start Site91815842
End Site91816428
Strand-
Exon Number1
CNCI Score-0.0258048
Length586
Assemblyhg38
Other transcript VersionsNONHSAT114000.1(old version)

Sequence


>NONHSAT114000.1
CAGTGTCCTCCAGCAATGGTTCCCGTCCAGAAGAAGCTGGTAATTGTCGGTGACAGAGTCTGTGGCAAGACATGCTTGCTCATTGTCTTCAGCAAGGACCAGTTCCCAGAGGGGTGAGCACCCTCAGGGTTTCAGAACTATGTGGCCCATATCGAGGTGGATGGGAAAGTGTAGAGCTGACTTTGTGGGACACAGCCAGGCAGGAAGATTAGGATCGCCTGAGGCCCCTCTTTTACTCGGACACTGATGTTATGTGTTCTCCGTTGACAACCCTGAGAGTTTAGAAAACATCCCAGAGAAATGGAGCCCAGAAGTCAAGCATTTCTGTCCCAACGTGCCCACCAGCCTGGTTGGGAACAAGAAGGATCTTCGGAATGATGTGCACACAAGGTGGGAGCTAGCCAGGATGAAGCAGAAGAGGGTGAGACTCGAAGAGGGCAGAGATATGGTCAAGGGAATTGGCTCTTTGGGGTACATGAAGTGTTCAGCAAAGACCAAAGATGGAGTGAGAGAGGTTTTTGAAGTGGCTGCGAAAGCTACTCTGCAAGCCAGATGTGGGAAGAAAAACTCTGGGTGCCTTGTCTTG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-MAP3K7-6-1
NONCODEv4NONHSAT114000
ensemblENST00000406314