An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT114428.2

General info


NONCODE TRANSCRIPT IDNONHSAT114428.2
NONCODE Gene IDNONHSAG044592.2
Chromosomechr6
Start Site110598092
End Site110598705
Strand+
Exon Number1
CNCI Score-0.1064960
Length613
Assemblyhg38
Other transcript VersionsNONHSAT114428.1(old version)

Sequence


>NONHSAT114428.2
AAAATTCACAAGTTATTTTTGTTCCTGGCTGTCTTTCTCATATAAACGGTACAAAAGTACTGGCAACTGAGAAGTTTTGTGAATCTCTAGGCCACGCCTTATAAGATATGATCACTTAGGAGTTGGAAGTACGGATGGTAATTTATGAGAACCACAGTGTAGAAATAGAGGAATTATGTTCCCTTTAGAATCTCAGATGCAGGTGGATCCAGACTAGCTGGGTGGCTTCTTTTTAATGTTGCAATTGAACGTCCAGAAAAGATAGTTGCTCCTTGGTAGAACCACAGCTATAAATGGTATAGAAATACAATTTAGTGAACTTTTCCTTGCTGATGTAGGAGGAACAAAAGGAGGTGATGGGTGATGTCACCAAAACACAACAAAAGAGTGCCTCATTTTTTCAAGAGTTTCGTTAATGAAGCCAGGTCCTGGTGCTTGTTGGACAGCCCGCTGCTTGTGGGAATGCCTCCAGGCACGAGGAGTGGTGCCCTTCTTGGCATTCACTCATGCAAAATGGCTAACCCAGTCATCTGTACAGATACAGATGTCATCCTCTGTCAAAAGAGTGATCATCAAATGAAGGAGATAAAGAACATTGAACTTTGTATTTATA

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00000000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000000
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
02.31973004.6629
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
9.52474006.264030
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-AMD1-4-1_dup1
NONCODEv4NONHSAT114428
ensemblENST00000603085