An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT114899.1

General info


NONCODE TRANSCRIPT IDNONHSAT114899.1
NONCODE Gene IDNONHSAG044825.1
Chromosomechr6
Start Site130454656
End Site130459341
Strand-
Exon Number2
CNCI Score-0.0292391
Length769
Assemblyhg19
Other transcript VersionsNONHSAT114899.2

Sequence


>NONHSAT114899.1
CTAAACAAGGCTGATATAATTAAATTGCTACTTCTTAAGATTTTCCTCTCTCCTTTAAAAATGAAAGACCTGTAAATATAGACTGCCTAAATGCTTCATCAGTAAGAACTGGAGTCATCTTACACAACTTCTTCAAGTAACAATTATGTGGAAAAAGTGTGCTAATTTCAGTAAAAAGACATCCTGCTGTTGTAAACTAGAAGGAAAGACGTTCCAGTGTTAATCTCCAAGTGTAGCACCGTTAAGCGGCAGGTATGAGAAATGTTCTCCTGTTTTCTGGAAACATTGGTCTGTTCTCATTTGCTTGTGCTATGACAGTCCTCTGATAAAGCAAGGTCAGGAAGAAAGGCAGATCTATTAACACTTCGCTCAACCAAGGCAGACCTTAGTACAATGGACAGCCTTATAGAAGTCTTCTAAGTCATTAATGAAAATGTCAACTGACATTCCCAAGGAGCCCACTACAAAGGCTGACTGGTTTATTACAACCTTGGCCCTACTGAAGGCCTGGCGCAGACAGCAAGTCTCCTTCTGAAACTATGTAAGAGTATAACACAACAGAAAAAAAAAGACTAAACGCTACCTACGCTCAATGTTCCACACCTCTTAAGCCAGTAATCCTGTATCTGGTGTCGGGCAGCAAAGAAAATAAAATATACCTCGTCTGTGCTCCATTTGGAAACTTTACTGGCAGGGATTCCTGCGACAGTTGGAAGAAGTTTGCTTTGCTGCTCCCAGCGCAAGGGCAGACATGGAATTGGGGACTTAA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT114898.1

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA102343
lncipedialnc-SAMD3-1-3
ensemblENST00000591297
gencodeENST00000591297.1
NONCODEv4NONHSAT114899