An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT114914.1

General info


NONCODE TRANSCRIPT IDNONHSAT114914.1
NONCODE Gene IDNONHSAG044833.2
Chromosomechr6
Start Site131184324
End Site131185486
Strand-
Exon Number1
CNCI Score-0.0987136
Length1162
Assemblyhg38
Other transcript VersionsNONHSAT114914.1(old version)

Sequence


>NONHSAT114914.1
ATGGCACCTGTGGTGGTGAATGCAATGAAGTTCCTTGGGAGCAGTACTACAAAGATGCCATGGAGCAGGGCCACAATTACAATGCCCACCTCTGTGCTGAGCACAGCATGTGCCTGCCTTTCTTGGCCTCACAGACTGGAGTAGCCCAGAACAATTATTACAGCTGGATGAAGAAGTAACCAGGTTCTAGGATTGGCCTCTGGACAACTACTCGTACCCTGCCCAGCACTGGCGGAAAAAGCGGTGAGCCCACCCCTGTGAAGATCCACAATTTTTCTTCCCACCTATTAAGCCAGACACAGACCCCACCCTGAAGAAGGAGGGGCTGATCTCTCAGGACAGCAGCAGTTTAGAGGTTCTGTTGCACACTGACCCCCTGGGGAAGCGAGGTACCCCAGATCCCCGAGTTGATGATGACAGCCTGGGCAAGTTTCCTGTGACAAACAGTCAAGCACGAAAGCGGATCCTAGAACCAGATGACTTCCTGGATGACCTCGATGATGAGTACTGTGAAGATGCTCCCAAGCATCGGGGAAAGGGGTAATCCAAGGGTAAAGGTGTGGCAGTGCCCATAAGGAGCTGGATGCTTCCAACCTGGAGGACCAGGATAAGCCCTATGCCTGTGACATTTGTGGAAAACGTTACAAGAACCGACCAGGCCTCAGTTACCACTATGCCCACTCTCACTTGGCTGAGGAGGGCGAGGACAAAGAAGACTCCCAACCACCCACTCCTGTTTCCCAGAGGTCTGAGGAACAGAAATCCAAAAAGGGTCCTGATGGATTTGCCTTGCCCAACAACTACTGTAACTTCTGCCTGGGGAACTCAAAGATTAACAAGAAGATGGGACAACCTGAGGAGGTGGTGTCCTGTTTCGACTGTGGCTGCTCAGGGCATCCATCTTGCCTCCATTTCACCCCCATGATGATGGGGCAGTGAAGACATACTGCTGGCAATGCATCGAGCACAAATGTTGCGATATCTGCGGCACCTCTGAAGATGATGACCAGCTGGGCTTTTGTGATGCTGCGATCATGGCTACGAAATGTACTGTCTCACTCCGTCCATATCTGAGCCCCCTGAAGGAAGTTGGAGGTGCCACCTGTGTCTGGACCTGTTGAAGGAGAAAGCTTCCATCTACCAGAACAAGAACTCCTCTTGA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000407765
NONCODEv4NONHSAT114914
lncipedialnc-EPB41L2-2-1