An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT115807.1

General info


NONCODE TRANSCRIPT IDNONHSAT115807.1
NONCODE Gene IDNONHSAG045264.1
Chromosomechr6
Start Site159146778
End Site159147835
Strand-
Exon Number1
CNCI Score-0.0818019
Length1057
Assemblyhg19
Other transcript VersionsNONHSAT115807.2

Sequence


>NONHSAT115807.1
ATGCAAACAGTATGGCACTCTGAACAGACACTGAAAACATCTCCATCTCAAAGATCCCAGGCCTTGTGTCACAGTATGGGAAATTAGATGCTGGGGAAAACAGTGCTGAATGAACGAAGGCTTCCAGCCAGCCAGTGATCTCTTTGGACCCATTACTTTGCATTCCCAATCATATTAGATCACTTCCCATCCAGAGGCTCCCCAAGACTTTGAACAGTTCTTCAGTGGCCCTTACAGAAAGACACTCTCTCCAGACAAATGAGTATTTATATTCAGTCCGCTGGATCTCTAGGAAACACCAGAATTATCAATGAAGAATCTATGAAATGGCTCAAGGCCTATTGGGAGGCATAATTCTACGGCTTGAGAGCAAACCTCCTAGAACTGGTTCCTGTTTCTGCAATGAGGTGTTCCTTTAGAGCCAATGATAATTCACAAACAAAGCCTACAAGTTCATGCAGGGGACATCTTGAAGTTCTTAAAAAAGAAGAAACCTGAAGACGCCTGTGTCATGGGGATAACAATGATTGATCTTTACCCAAGAGACTCCTGAAATTTTGTCTTTGGACAGGCCTCTTTGACAGATGGTGTAGGGATATTCAGCTTTGCTAAGTATGGCAGTGATTTTTATAGCTTGTGCTATGAAGGCAAAGGGAGGAAGTGACAGAAAACATCTTCAACTGACTATTCAATTTTTGATAACTATTACATTCTGGAAAGAACTAATGTTTCACTACATTGATCCTGTAAGATTTTAACACATGAGATTGGACACACACGTGGACTGCGACACTGTCAGTGGCTTGCATGCCTAACGCAGCTCCAACCACTTGGAAGAAGCTGACCGGCGCCCTCCTGCCCTATCTGTTTACGCGAGTTGCAGAATGCTGCATTATAGAAAGCTACAGAGCACTGGTGGAGTGGATTGATAATGAATCTGCTGACACACCTGGAGTAACTCCAAGACACAGGCCTGAGGATAACGCAACTTTACTAAAACCTGTGGAAGCCTTTAAGGAATGGAAGGATGGATAATAAAATGCCTTGCTGTTCTCCA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000406819
NONCODEv4NONHSAT115807
lncipedialnc-EZR-2-1_dup1