An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT115978.2

General info


NONCODE TRANSCRIPT IDNONHSAT115978.2
NONCODE Gene IDNONHSAG045360.2
Chromosomechr6
Start Site163840560
End Site163840850
Strand+
Exon Number1
CNCI Score-0.0778240
Length290
Assemblyhg38
Other transcript VersionsNONHSAT115978.1(old version)

Sequence


>NONHSAT115978.2
gctgggtgtagtggcacacacctgtagtcccagctgtttgggaggctaaggcaggaggatggcgtgagaccaggagttctgggagctatgctgattgggtgtccacactaagttcagcatcaatatagtgacttctcgggagtgggggaccaccaggttgcctaagaaggaggagagccagcccaggttggaaatgaagcaggtggaaacatctgtgctgatcagtagtgggagtatgcctgtgaatagccactgcactctagcttgggcaatgttgcatgaccccttct

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00000000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000000
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00.93970601.0117515.7702
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
8.78910015.50050
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT115978
ensemblENST00000577957
lncipedialnc-QKI-9-1_dup1