An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT118572.1

General info


NONCODE TRANSCRIPT IDNONHSAT118572.1
NONCODE Gene IDNONHSAG046710.1
Chromosomechr7
Start Site80302
End Site80886
Strand+
Exon Number2
CNCI Score-0.3553632
Length245
Assemblyhg19
Other transcript VersionsNONHSAT118572.2

Sequence


>NONHSAT118572.1
GGAGCTGCAGGCCGGTATCAGAGCCCGTATCAGAGCAGAGTGGCCCCTGAGCGGGGAGGCAGCTGGAGCTCACTGTTGGAGGAGGGCCCGGCACCTGCACCTGAGGACATGAGTCTGAGGCCTGCGGAGAAGCCAGACCTTCACCTGGGGCTCTAACACCGAAAGTCTGTGCCAGACAGAGGCATCCACAGCGACAGGAGCCTGGGCCAGGGCGGCCATCCCTGCTGCAGAGACAAATGTCAGTG

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT118571.1

Data Sources


Source NameOld Id
noncodeV3n369721
noncodeV3Human
lncipedialnc-FAM20C-5-2
NONCODEv4NONHSAT118572
PMID26117828PNCT_HSA296204