An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119666.1

General info


NONCODE TRANSCRIPT IDNONHSAT119666.1
NONCODE Gene IDNONHSAG096227.2
Chromosomechr7
Start Site27096169
End Site27099966
Strand+
Exon Number3
CNCI Score-0.0450560
Length700
Assemblyhg38
Other transcript VersionsNONHSAT119666.1(old version)

Sequence


>NONHSAT119666.1
GACGCGCAGTCGCCCCCCCAGGCAGCCTAGGCGGCGGCAGCTGCTGCGGCGACTGCAAAGGCCGATTTGGAGTGCTGGAGCGAAGAAGAGCAAAAGCTGCGTTCTGCGCGCGCCCGACTCCGCTGCCCGCCCCGCCAGGCCTCCGGGAGGTGGGGGCTGGGAGGCGTCCCCCGCTCCCGCCCCCTCCCCACCGTTCAATGAAAGATGAACTGGCGAGAGAAAGCGTTTGATTTATGAGCGTAGGACGAATCGCATCCAGGAGCTGCGCAGCCCTGGCCGCTGCCGGGACGCCCTGCTCCGCGCTGAGCTTGGGGCCAGAAACCAGCCATAGTCCCCACACTCCGCCGCCGCAGCTGAGATTTAGCGGAGGAAGGGGCGAGGGAAGGTAGGGAGCAAACCTATGAAGAAACATCGCGTTGTCATTGGAACTTCCAAGCCTTTGCTGTTAAGAGCCAGGTTCTTAAATCAACCCGCCCCACACACATGTTGCTTACATGCTGCGTTTTCTCACGGTCTGTTTTGCCTGAACCCATCAACAGCTGGGAGATTAATCAACCACACTGAAAATGTGGAGGGATTTATGGGGGAGGGGGTTGAAATGTGGGTGTTTGAAACAAAAGTGTATAAACAAATGAATTGTTGATAACTTAGTTATTGACCTGGAGACTGGTAGCTTATTAAAGAAACTCCGTGTTACTCA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211834.1
NONHSAT211835.1
NONHSAT211836.1
NONHSAT253212.1
NONHSAT253213.1
NONHSAT253214.1
NONHSAT253215.1
NONHSAT119664.2
NONHSAT119665.2
NONHSAT119667.2

Data Sources

Source NameOld Id
ensemblENST00000425358
gencodeENST00000425358.2
NONCODEv4NONHSAT119666
PMID26117828PNCT_HSA107377
lncipedialnc-EVX1-13-4_dup1