An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119670.1

General info


NONCODE TRANSCRIPT IDNONHSAT119670.1
NONCODE Gene IDNONHSAG047182.2
Chromosomechr7
Start Site27109196
End Site27122876
Strand+
Exon Number3
CNCI Score-0.0217088
Length1186
Assemblyhg38
Other transcript VersionsNONHSAT119670.1(old version)

Sequence


>NONHSAT119670.1
GAGATGGGCAGACTGGAAACCTCAAACTGGAAGGCCTTCTCTGCCCAAAGAAGAGATCCCATTGAAGGCTGTGCTGGATGTCGTGGGCAGTAGCTTGGGGACCAGGAGCCAGGCCAGAGGACCCTCTTCCAGAAGGCACTCCTTTACCTGAGCTGGAGCTGCTGGTTTTCTGCTTTGTGTTTTGTCGAGACTCTTTCATCCAGGGGAAGATTTGTTTGGCCACTGTGGGAAAAGGAAACGCCAAGACATAGAAAACCACGCTTTTCCCGTAGGAAGAACCGATGATGAGCCCTGATGAAAGAAGGAAGAAGACCCGCTGTCTGCGAAGGCCTAAAGGTTAGAAATACAGCAATTTTTCTCATGCCGAAGGAAAGGCAAAATGGTCTAAGAAACTGCAAGAGTGTGATACAAGTTTTCCTCAACAGCGAGCTGGGACTGGCGACAATTTCTTAACTCACAGCCTCCGCAGTCGCCTTAGTCGACAAAGAGAGCAGCCCACGCAGCGGCCGCCGCGCCCGTGCCCGTGGCCTTTACTTGCTTTTGCCCTGAAGTTCAGTGTAGTGGTTTGTTTGGGGCTTGCAGGAAGAAACAAACACACTCCCTCTGACTCTCCACAACCCATCTTTGCCTTCTGCAACCGCTTCTCCTGCCCATCGCTGGTTTTGGGGTAGGCTCTTTGTCTGCCTGAGGCCCCGCACTCGCAGGGCAAGAAGCTTAAAGGAATCCAACTCCAAACTCCTCCGAAGTTAAATATTGACCAGAACCTCTTTCAACAGGCCGCGGTTGCCAGGAACCGTGGAGGGCCAACTCCTCCCAACCGCCCTGGTGCAAAGTCCCACGCGGCGAAGAGTTTTGGAGCAGCGCTTACCTAGAAAGATGTTTAAATTCTGAACCAGGAATTGTCTCCAACTCCAGGCGCTCAGGGAATCGCCTTTTCCGGTGTCCAGGCGCTCTGCAGACAAATAAACAGCAGAAGGTGAATGGCGGCTGCGAGGGAAGGGAGTTGGAGGCCGGGAGTGGGAAGCGAGGCTCATGCGGGCGCCAAGGTGGCCCTGGGGGTGACGCGAACATCAGGGAGTCACCAGGGCACTCGTCCGTGTGGCGCACTCATTGCTCGAAATGTTCCAGTCTACAAATGGTCCGAAGATGGTGATTTATTTTTGTAAAATAAATACATACTCCATCT

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211839.1
NONHSAT211840.1
NONHSAT119669.2
NONHSAT119672.2
NONHSAT119673.2
NONHSAT119675.2
NONHSAT119676.2
NONHSAT119677.2
NONHSAT119678.2
NONHSAT119680.2

Data Sources

Source NameOld Id
lncipedialnc-EVX1-10-11_dup1
NONCODEv4NONHSAT119670
PMID26117828PNCT_HSA107380