An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119672.1

General info


NONCODE TRANSCRIPT IDNONHSAT119672.1
NONCODE Gene IDNONHSAG047182.2
Chromosomechr7
Start Site27113935
End Site27122199
Strand+
Exon Number2
CNCI Score-0.0638976
Length339
Assemblyhg38
Other transcript VersionsNONHSAT119672.1(old version)

Sequence


>NONHSAT119672.1
CCGGAGATAAGCGCTAGTGCGGCGCCGGGCTCTGCCTGGGCTAGTGGCACCGACTTGGGAAAAGGAAACGCCAAGACATAGAAAACCACGCTTTTCCCGTAGGAAGAACCGATGATGAGCCCTGATGAAAGAAGGAAGAAGACCCGCTGTCTGCGAAGGCCTAAAGGTTAGAAATACAGCAATTTTTCTCATGCCGAAGGAAAGGCAAAATGGTCTAAGAAACTGCAAGAGTGTGATACAAGTTTTCCTCAACAGCGAGCTGGGACTGGCGACAATTTCTTAACTCACAGCCTCCGCAGTCGCCTTAGTCGACAAAGAGAGCAGCCCACGCAGCGGCCG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211839.1
NONHSAT211840.1
NONHSAT119669.2
NONHSAT119670.2
NONHSAT119673.2
NONHSAT119675.2
NONHSAT119676.2
NONHSAT119677.2
NONHSAT119678.2
NONHSAT119680.2

Data Sources

Source NameOld Id
gencodeENST00000522193.1
ensemblENST00000522193
noncodeV3n380182
NONCODEv4NONHSAT119672
lncipedialnc-EVX1-10-2_dup1
PMID26117828PNCT_HSA297846