An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119673.1

General info


NONCODE TRANSCRIPT IDNONHSAT119673.1
NONCODE Gene IDNONHSAG047182.2
Chromosomechr7
Start Site27115404
End Site27122173
Strand+
Exon Number2
CNCI Score-0.0491520
Length422
Assemblyhg38
Other transcript VersionsNONHSAT119673.1(old version)

Sequence


>NONHSAT119673.1
CAAAAATCCGTTCGGCGGCATTTTCTCTTCAAACCCGCCCGGTCGGATGTGGCATTTGAAGAAAGAAGGCGTGGGTCAATAATCAACCCGCACTTTCTCCTCCAAACTGCTGACGCGACTCTCACCGCCTTCTCAGCTAAGCCAGCTGCCGGGAAGGCCAGCTCTCCGAAAAGGAAACGCCAAGACATAGAAAACCACGCTTTTCCCGTAGGAAGAACCGATGATGAGCCCTGATGAAAGAAGGAAGAAGACCCGCTGTCTGCGAAGGCCTAAAGGTTAGAAATACAGCAATTTTTCTCATGCCGAAGGAAAGGCAAAATGGTCTAAGAAACTGCAAGAGTGTGATACAAGTTTTCCTCAACAGCGAGCTGGGACTGGCGACAATTTCTTAACTCACAGCCTCCGCAGTCGCCTTAGTCGAC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211839.1
NONHSAT211840.1
NONHSAT119669.2
NONHSAT119670.2
NONHSAT119672.2
NONHSAT119675.2
NONHSAT119676.2
NONHSAT119677.2
NONHSAT119678.2
NONHSAT119680.2

Data Sources

Source NameOld Id
lncipedialnc-EVX1-10-4_dup1
gencodeENST00000518046.1
PMID26117828PNCT_HSA297848
noncodeV3n380091
NONCODEv4NONHSAT119673
ensemblENST00000518046