An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119674.1

General info


NONCODE TRANSCRIPT IDNONHSAT119674.1
NONCODE Gene IDNONHSAG047184.2
Chromosomechr7
Start Site27116035
End Site27116664
Strand+
Exon Number1
CNCI Score-0.0040960
Length629
Assemblyhg38
Other transcript VersionsNONHSAT119674.1(old version)

Sequence


>NONHSAT119674.1
TCCAGAAATTACCAGCCGCCGCCGCTGCGCCCTTTCTAGACAAATCCCACAGCAGTTCACCCGGCTCCCCCAAAACCGCAGAGCTTTTCTTTACTGAGAGGACCCCTTGGTTCCACCAATTCCCCCAAATCCCCGTGGCTCCCGATCTCTCATCCAGGGGGACTAGAAGAAAAGATTTTCTCAGCACTAGAAGAATACTTGGAGCAGCAAAGGTGCCCGTGGTGTCTTTCTACCATTCAAGGGGTGTCCTCCTGAAGGCGTCTGAGAGGGCCTCTGGCGGTTCCAAGGCTGTGCAGCCGGGGAGGAAGGTGAGGAATATCGTGGGTAAGAAGAGGCACCAAAATCACAGAATAGAGAGGAAAATTATTGAGGAAATGTACTTGCCTGTGAGGGTGAAGCTGGCATTTCGAGGTAGAAGGGGACTAGCCTTTTTTGATATCTAATAGTTTAGCATTATACGTAATGGACTCACTTTAGCACTTTCATGGGAGGAAAAACCAATCTGAGCTCTATAAATGTGGCTCTTGGCTTCTCACTGTGCATGCTTTTATGTAGAACCAGAGTCCATCCTTAGATATTTATTCAGCTTGCTGGCACTGAAGCAACAATAAAAAGATGCCTCTAACAAA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT119674
ensemblENST00000593438
gencodeENST00000593438.1
lncipedialnc-EVX1-10-12_dup1