An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119675.1

General info


NONCODE TRANSCRIPT IDNONHSAT119675.1
NONCODE Gene IDNONHSAG047182.2
Chromosomechr7
Start Site27120936
End Site27122650
Strand+
Exon Number2
CNCI Score-0.0028672
Length989
Assemblyhg38
Other transcript VersionsNONHSAT119675.1(old version)

Sequence


>NONHSAT119675.1
ACTCACTTCACCGGCCTCCAACTTGGCCTGCGCTGGGACTGATACTGTGGTCCTGGTCACCAGAGCCAAAATAGGGGGAAAGCTGGCTTGGAAAAAGCAGGCAACCAAGGGTACACACCGTTAGCCAATATTTGCAAGGCTGTTGGCAGATTAGATATATCTGTACTCAAACACTGCAATCTGATTTCTCTGTCAAAAGTACACTTAACATTTTTGTCCCATTACTTAAATCTAGTGGATTTTCTACTCAGCATCAGGAAAAGGAAACGCCAAGACATAGAAAACCACGCTTTTCCCGTAGGAAGAACCGATGATGAGCCCTGATGAAAGAAGGAAGAAGACCCGCTGTCTGCGAAGGCCTAAAGGTTAGAAATACAGCAATTTTTCTCATGCCGAAGGAAAGGCAAAATGGTCTAAGAAACTGCAAGAGTGTGATACAAGTTTTCCTCAACAGCGAGCTGGGACTGGCGACAATTTCTTAACTCACAGCCTCCGCAGTCGCCTTAGTCGACAAAGAGAGCAGCCCACGCAGCGGCCGCCGCGCCCGTGCCCGTGGCCTTTACTTGCTTTTGCCCTGAAGTTCAGTGTAGTGGTTTGTTTGGGGCTTGCAGGAAGAAACAAACACACTCCCTCTGACTCTCCACAACCCATCTTTGCCTTCTGCAACCGCTTCTCCTGCCCATCGCTGGTTTTGGGGTAGGCTCTTTGTCTGCCTGAGGCCCCGCACTCGCAGGGCAAGAAGCTTAAAGGAATCCAACTCCAAACTCCTCCGAAGTTAAATATTGACCAGAACCTCTTTCAACAGGCCGCGGTTGCCAGGAACCGTGGAGGGCCAACTCCTCCCAACCGCCCTGGTGCAAAGTCCCACGCGGCGAAGAGTTTTGGAGCAGCGCTTACCTAGAAAGATGTTTAAATTCTGAACCAGGAATTGTCTCCAACTCCAGGCGCTCAGGGAATCGCCTTTTCCGGTGTCCAGGCGCTCTGCAGAC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211839.1
NONHSAT211840.1
NONHSAT119669.2
NONHSAT119670.2
NONHSAT119672.2
NONHSAT119673.2
NONHSAT119676.2
NONHSAT119677.2
NONHSAT119678.2
NONHSAT119680.2

Data Sources

Source NameOld Id
ensemblENST00000523364
PMID26117828PNCT_HSA297849
gencodeENST00000523364.1
lncipedialnc-EVX1-10-5_dup1
noncodeV3n380208
NONCODEv4NONHSAT119675