An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119677.1

General info


NONCODE TRANSCRIPT IDNONHSAT119677.1
NONCODE Gene IDNONHSAG047182.2
Chromosomechr7
Start Site27122442
End Site27123818
Strand+
Exon Number2
CNCI Score-0.0393216
Length583
Assemblyhg38
Other transcript VersionsNONHSAT119677.1(old version)

Sequence


>NONHSAT119677.1
ATTGACCAGAACCTCTTTCAACAGGCCGCGGTTGCCAGGAACCGTGGAGGGCCAACTCCTCCCAACCGCCCTGGTGCAAAGTCCCACGCGGCGAAGAGTTTTGGAGCAGCGCTTACCTAGAAAGATGTTTAAATTCTGAACCAGGAATTGTCTCCAACTCCAGGCGCTCAGGGAATCGCCTTTTCCGGTGTCCAGGCGCTCTGCAGACAAATAAACAGCAGAAGCAAATGGTCACCGAGCCGGCAGTCAGCTTTCTGGGAGTGGGAGATGATGGGGAAAGAGGAAAGAATCGTCCGCTCGCCGGACCCTGGCTTGGAGAAGTTCTGCGCTCCGCTGGGACTCTGCGGGCCCTTTGCGTCTACAGACCTATCCCTGCCCCGACTACCCCTTCACTCAGACCCAGGTAACCTCTTACCCCAGCCTGCCCCAAACCAGCCCTCCGCTGTCTGTCTGCCTTCACGCAATTCTGTAGATAGCGCTAAGAGGGGATATCAAATAGCTGAGGAGTCCCCTGACCCCTGGCTTCGGAGCCCCCTAGCACGTGGAACAAGTGGCCGCACACCGGTAGCTGCGCTCTGCCACA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211839.1
NONHSAT211840.1
NONHSAT119669.2
NONHSAT119670.2
NONHSAT119672.2
NONHSAT119673.2
NONHSAT119675.2
NONHSAT119676.2
NONHSAT119678.2
NONHSAT119680.2

Data Sources

Source NameOld Id
lncipedialnc-EVX1-10-7_dup1
NONCODEv4NONHSAT119677
PMID26117828PNCT_HSA297851
ensemblENST00000517641
noncodeV3n380074
gencodeENST00000517641.1