An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119678.1

General info


NONCODE TRANSCRIPT IDNONHSAT119678.1
NONCODE Gene IDNONHSAG047182.2
Chromosomechr7
Start Site27122547
End Site27134302
Strand+
Exon Number4
CNCI Score-0.0606208
Length800
Assemblyhg38
Other transcript VersionsNONHSAT119678.1(old version)

Sequence


>NONHSAT119678.1
GCAGCGCTTACCTAGAAAGATGTTTAAATTCTGAACCAGGAATTGTCTCCAACTCCAGGCGCTCAGGGAATCGCCTTTTCCGGTGTCCAGGCGCTCTGCAGACAAATAAACAGCAGAAGCAAATGGTCACCGAGCCGGCAGTCAGCTTTCTGGGAGTGGGAGATGATGGGGAAAGAGGAAAGAATCGTCCGCTCGCCGGACCCTGGCTTGGAGAAGTTCTGCGCTCCGCTGGGACTCTGCGGGCCCTTTGCGTCTACAGACCTATCCCTGCCCCGACTACCCCTTCACTCAGACCCAGCCTTCCCCAGCGTGAATCAGAACATTACCAACTGTCTGCGCATCCGTCCCACTTCATCACCAAAGCCAGGATGTGACCGCAGAAAACCCAAGCCCGAACTCACGTTTCCCCGGACGCGGCGCGCTCCCTGGACTCGCAGAAACCCTGCGGAAAAGGCCCCAAGATCTGGTGAGGGCCTGCCAGCTCCGTCCTCCCTGCCGAGGGCTCTCTCCTGCCTTCCTGAAGGAGTTAAAAGCCTTTGGAGATAAATCTGAGGGTGTGTGTTTTTAAAAATCAAATGAGCGAGAGTCCCCCAGACTGTTCTCTATCTGATGCATGTCTCTAGAGCTGAACAGTGGAATGGCAGAATTTCAAAACGCCTGATGGTGGCATTTGAAGGCTTCCCCACCACCTACACTAGACACAAGATTTGAGAGGAACAACACTTTACCAGCCATTTGACCAATTAATTCTTTGGGGATAATTTTCTTGTAGTAGTTTAAAATAATGCACACAACGCAGG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211839.1
NONHSAT211840.1
NONHSAT119669.2
NONHSAT119670.2
NONHSAT119672.2
NONHSAT119673.2
NONHSAT119675.2
NONHSAT119676.2
NONHSAT119677.2
NONHSAT119680.2

Data Sources

Source NameOld Id
lncipedialnc-EVX1-10-8_dup1
gencodeENST00000521159.4
ensemblENST00000521159
noncodeV3n380160
PMID26117828PNCT_HSA297852
NONCODEv4NONHSAT119678