An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119685.1

General info


NONCODE TRANSCRIPT IDNONHSAT119685.1
NONCODE Gene IDNONHSAG047183.2
Chromosomechr7
Start Site27147365
End Site27152598
Strand-
Exon Number2
CNCI Score-0.0126976
Length368
Assemblyhg38
Other transcript VersionsNONHSAT119685.1(old version)

Sequence


>NONHSAT119685.1
TGCGAGAATAGAGCCGCATTCTTTTGCTCCGCTCCGTCCTGCCTGCTTCGGAGCTCTGCCTTCCAGCCGGGCTCGGCTGTGCTTTGTCCGGAGATGGCGAGCGAAGGGAAGCCCCGGCCAGGCCAGGCCTGGCGGCTCCCGCTGGAGATTGGGCGCGCTCCGTTCCCGGCGCCGCGGCAGCAGCTTTGCAACTCGCAACCTGGCTAATTTCCTGCGTCCTCTGGCACCAGGAAAGAGGACAATTCTTCTCTCGGGCTGCCCAAGCGACAGCTGTCAGAGGGGCAGGAGCTTCTGGGAGCCACCGTCTGAAGCAGTACAAACCCGACAGCAGCAGCGGGCAGGGCAAAGCACTCCATGACGAAGGCGCC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-HOXA4-1-1_dup1
NONCODEv4NONHSAT119685
gencodeENST00000498652.1
ensemblENST00000498652
PMID26117828PNCT_HSA107386